Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression of PP2Ac activates JAK3/STAT5 signaling in human Tregs. Expanded human Tregs were lentiviral transduced with control vector or a plasmid encoding PP2Ac, and cultured in SFM with anti-CD3/CD28 beads and IL-2 for 3 days before analysis. (A) Transduction efficiency was assessed by the percentage of GFP+ cells. (B-D) Expression of PP2Ac in GFP+ cells was assessed at the mRNA and protein levels using qPCR (B), Western blotting (C), and flow cytometry (D) (n=3). (E) A representative immunoblot (left) and densitometry analysis of the resulting data (right) of protein extracts from transduced Tregs were probed for tyrosine-phosphorylated JAK3 (Tyr980/981), total JAK3, tyrosine-phosphorylated STAT5 (Tyr694), PP2Ac, and β-Tubulin (n=3). (F) IL-2-induced pSTAT5 dose-response curves of transduced Tregs (GFP+Foxp3+) (left) and nonlinear regression analysis of the binding data (middle) to determine EC50 (right) for IL-2-induced pSTAT5 activation (n=6). Data in plots are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B-F). *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, Transduction, Plasmid Preparation, Cell Culture, Expressing, Western Blot, Flow Cytometry, Binding Assay, Activation Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression of PP2Ac upregulates IL-2-dependent genes in human Tregs. Tregs from different healthy adult donors (n=3) were expanded and lentiviral transduced in vitro. Total RNA was isolated from vector-transduced or PP2Ac-overexpressed Tregs 3 days after lentiviral transduction and analyzed by real-time qPCR. Data were normalized to the mRNA level in the control vector-transduced cells. The sample in each graph with the highest fold change is from the same donor.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, In Vitro, Isolation, Plasmid Preparation, Transduction

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Increased expression of CD25 induced by PP2Ac overexpression does not fully account for enhanced pSTAT5 activation. Expanded human Tregs from different healthy adult donors (n=4) were lentiviral transduced with control vector or a plasmid encoding PP2Ac, and analyzed 3 days later. (A) CD25 level of Foxp3+ GFP+ transduced Tregs. Numbers represent MFI of CD25 for the indicated cell population. (B) Representative gating strategy of FACS plots to identify transduced Tregs with a similar MFI of CD25 (represented in the P5 gate). (C) IL-2-induced pSTAT5 dose-response curves (left) of control or PP2Ac-overexpressed Tregs with similar CD25 levels, as shown in Fig. 5B. Nonlinear regression analysis of the binding data (middle) was conducted to determine the EC50 (right) for IL-2-induced pSTAT5. (D) MFI of pSTAT5 vs. CD25 levels in control and PP2Ac-overexpressed Tregs after stimulation with IL-2 (1 unit/mL) for 15 min (n=4). Representative gating strategy (left) and quantified data (right) where the MFI of CD25 was normalized to 1 based for the gated cell with the lowest amount of CD25. Data (C, D) are shown as means ± SEM and were analyzed by one-sample two-tailed t test (C) or a paired two-tailed t test (D). *P < 0.05, **P < 0.01, ****P<0.0001.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Expressing, Over Expression, Activation Assay, Transduction, Plasmid Preparation, Binding Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: PP2Ac increases survival, activation, and immunosuppressive function of human Tregs. Representative histograms (A) and quantitative evaluation (B) of expression of the indicated markers for control and PP2Ac-overexpressed Tregs (n=4). (C) In vitro suppression assay of CD8+ T cells (responders) by control or PP2Ac-overexpressed Tregs (n=3). Data (B, C) are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B) or an unpaired two-tailed t test (C).*P < 0.05, **P < 0.01, ***P<0.001, ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Activation Assay, Expressing, In Vitro, Suppression Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Knockdown of PP2Ac reduces pSTAT5 response to IL-2 by human Tregs. Expanded human Tregs were lentiviral transduced with control or PP2Ac shRNA and analyzed after 3 days. (A) Transduction efficiency was assessed by the percentage of GFP+ cells. (B) Expression of PP2Ac was assessed by qPCR (n=3), western blotting (n=3), and flow cytometry (n=3) in control and PP2Ac knockdown Tregs. (C) FACS gating strategy for pSTAT5 activation analysis. Tregs transduced with PP2Ac shRNA were gated into two groups according to the knockdown efficiency. Numbers represent MFI of PP2Ac for the indicated cell population. (D) IL-2-induced pSTAT5 dose-response curves (left) for the indicated group of Tregs shown in Fig. 7C (n=6). Nonlinear regression analysis of the binding data (middle) was used to determine EC50 (right) (E) Representative histograms (left) and quantitative evaluation (right) of pSTAT5 MFI for indicated cell population after treatment with 40 and 400 pM of IL-2 (n=6). The numbers represent MFI of the gated pSTAT5+ cells. (F) Representative histograms of IL-2R subunit expression on control and PP2Ac shRNA transduced Tregs. Data (B-E) are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B, D-E) or an unpaired two-tailed t test (D).*P < 0.05, **P < 0.01, ***P<0.001, ****P<0.0001, ns, not significant;

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Transduction, shRNA, Expressing, Western Blot, Flow Cytometry, Activation Assay, Binding Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression and knockdown of PP2Ac does not alter pSTAT5 response to IL-2 by human Teff cells. (A-B) Expression of PP2Ac in freshly isolated Treg and TEM cells were assessed using Western blotting (n=3) (A) and flow cytometry (n=3) (B). (C) Quantification of the enzymatic activity of PP2A in freshly isolated Treg and TEM cells (n=3). (D, E) Transduction efficiency in vector-transduced and PP2Ac-overexpressed Teff cells (D) or in control and PP2Ac shRNA-transduced cells (E) was assessed by the percentage of GFP+ cells. (F, G) PP2Ac expression in control and PP2Ac-transduced overexpressed cells (F) or in control and PP2Ac shRNA knockdown cells (G) was assessed by flow cytometry (n=3). Teff cells transduced with PP2Ac shRNA were gated into two groups according to the knockdown efficiency and this gating strategy was used for pSTAT5 analysis in Fig. 8K. (H, I) Representative histograms for CD25 expression for control and PP2Ac-overexpressed (H) or for control and PP2Ac shRNA transduced Teff cells (I). The numbers in the FACS plots are the MFI of CD25 for the indicated cell populations. (J, K) IL-2-induced pSTAT5 dose-response curves (left) of control and PP2Ac-overexpressed (J) or control and PP2Ac shRNA transduced Teff cells (K). Nonlinear regression analysis of the binding data (middle) was performed to determine EC50 (right) (n=3). Data (A-C, F, G, J, K) are shown as the means ± SEM and were analyzed by a one-sample two-tailed t test (A-C, F, J, K).. *P < 0.05; ***P < 0.001; ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, Expressing, Isolation, Western Blot, Flow Cytometry, Activity Assay, Transduction, Plasmid Preparation, shRNA, Binding Assay, Two Tailed Test

Journal: PLoS ONE

Article Title: Defects of Protein Phosphatase 2A Causes Corticosteroid Insensitivity in Severe Asthma

doi: 10.1371/journal.pone.0027627

Figure Lengend Snippet: Effect of okadaic acid (OA; 10 −9 M) on corticosteroid sensitivity (A), GR nuclear translocation (B), phosphorylation levels of GR-Ser 226 (C) and JNK1 (D) in U937 cells (n = 3–4). E: Effect of PP2A siRNA on IC 50 of dexamethasone on TNFα-induced IL-8 (n = 7). Values represent means ± SEM. # P <0.05, ## P <0.01 (vs. non-treatment control; NT), * P <0.05.

Article Snippet: 2 µg of DNA/plasmids (pCMV6 Entry, OriGene Technologies, Rockville, MD) containing the human PP2A catalytic subunit, alpha isoform (PP2A Cα ) gene were transfected to U937 cells pretreated with 50 ng/ml of PMA for 4 h. 20 h after the transfection, the medium was changed to the appropriate treatment in 1% FBS medium.

Techniques: Translocation Assay

Journal: PLoS ONE

Article Title: Defects of Protein Phosphatase 2A Causes Corticosteroid Insensitivity in Severe Asthma

doi: 10.1371/journal.pone.0027627

Figure Lengend Snippet: Effects of IL-2/IL-4 co-treatment for 48 h on IC 50 of dexamethasone on TNFα-induced IL-8 release (A), PP2A C protein expression (B), immunoprecipitated PP2A (IP-P2A) activity (C), PP2A C -Tyr 307 phosphorylation(D), GR-Ser 226 phosphorylation (E) and JNK1 phosphorylation (F). Values represent means ± SEM (n = 3–4). # P <0.05, ## P <0.01 (vs. non-treatment control; NT).

Article Snippet: 2 µg of DNA/plasmids (pCMV6 Entry, OriGene Technologies, Rockville, MD) containing the human PP2A catalytic subunit, alpha isoform (PP2A Cα ) gene were transfected to U937 cells pretreated with 50 ng/ml of PMA for 4 h. 20 h after the transfection, the medium was changed to the appropriate treatment in 1% FBS medium.

Techniques: Expressing, Immunoprecipitation, Activity Assay

Journal: PLoS ONE

Article Title: Defects of Protein Phosphatase 2A Causes Corticosteroid Insensitivity in Severe Asthma

doi: 10.1371/journal.pone.0027627

Figure Lengend Snippet: PP2A C protein expression (A), PP1 protein expression (B), immunoprecipitated PP2A (IP-PP2A) activity (C), phosophorylation levels of GR-Ser 226 (D) and PP2A C -Tyr 307 (F) in PBMCs from severe asthmatics (SA) and healthy volunteers (HV). E. Correlation between PP2A C expression and GR-Ser 226 phosphorylation. The dotted lines show 95% confidence interval. # P <0.05, ## P <0.01 (vs. HV).

Article Snippet: 2 µg of DNA/plasmids (pCMV6 Entry, OriGene Technologies, Rockville, MD) containing the human PP2A catalytic subunit, alpha isoform (PP2A Cα ) gene were transfected to U937 cells pretreated with 50 ng/ml of PMA for 4 h. 20 h after the transfection, the medium was changed to the appropriate treatment in 1% FBS medium.

Techniques: Expressing, Immunoprecipitation, Activity Assay

Journal: PLoS ONE

Article Title: Defects of Protein Phosphatase 2A Causes Corticosteroid Insensitivity in Severe Asthma

doi: 10.1371/journal.pone.0027627

Figure Lengend Snippet: (A) PP2A C and JNK1 expression in GR-immunoprecipitates. Expression levels of PP2A C in GR (B)- or JNK1 (D)-immunoprecipitates. PP2A activity in GR (C)- and JNK1 (E) immunoprecipitates were also determined. Values represent means of four experiments ± SEM. # P <0.05, ## P <0.01 (vs. non-treatment control; NT).

Article Snippet: 2 µg of DNA/plasmids (pCMV6 Entry, OriGene Technologies, Rockville, MD) containing the human PP2A catalytic subunit, alpha isoform (PP2A Cα ) gene were transfected to U937 cells pretreated with 50 ng/ml of PMA for 4 h. 20 h after the transfection, the medium was changed to the appropriate treatment in 1% FBS medium.

Techniques: Expressing, Activity Assay